EST details — SGN-E375431

Search information 
Request: 375431Match: SGN-E375431
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180330Clone name: TUS-34-B8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180330 is on microarray TOM1 spot ID 1-1-1.2.19.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32901 [cLEG-24-H21] Trace: SGN-T67671 EST: SGN-E253423 Direction: 5' Facility: TIGR
Clone: SGN-C180330 [TUS-34-B8] Trace: SGN-T187198 EST: SGN-E375430 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375431Length: 208 bp (1024 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375431 [] (trimmed) GAAAAGGCCAGCCTTATCGTTGGAGGCATTTCTGAGAGAGCATTATTTATCAGGAACTCCGGTGGTAATCAGAGATTCCATGGATCACTGGCCTG
CTAAGAGTAGGTGGAATGACATGAATTATCTTAGAAGGGTTGCTGGCTTCCGTACAGTCCCGGTTGAGGTCGGAAAGAACTATTTGTGCCCAGAA
TGGAAGCAAGAGCTGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375431] SGN-U576053 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187199 [Download][View] Facility Assigned ID: FA0AAD22DA04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5