EST details — SGN-E375249

Search information 
Request: 375249Match: SGN-E375249
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180483Clone name: TUS-34-H17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180483 is on microarray TOM1 spot ID 1-1-8.4.19.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180483 [TUS-34-H17] Trace: SGN-T187150 EST: SGN-E375248 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375249Length: 250 bp (998 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375249 [] (trimmed) GAATCTGACTCAGTGAGAAGTCCTACTTCTCCACTGGATTTTAGGGTCTTTTCAAATTTGGGAAACCCCTTTAGGTCATCAACTAGTGAAGGGGC
TGGGGCTAACAAGACATGGGGTTGTACTAAAGTAGGCCTTGGCATTGTAGATTCTCTTGATGATGAAATGAAACATTCGGGGAAAGTTTTTCGAT
CATCCGATAGTAAAAATATTCTTTTTGGCACACAAATGAAGGATCCAAAGCACATGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375249] SGN-U565277 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187151 [Download][View] Facility Assigned ID: FA0AAD22CD09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5