Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E375208

Search information 
Request: 375208Match: SGN-E375208
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180673Clone name: TUS-34-P15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180673 is on microarray TOM1 spot ID 1-1-2.4.19.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32577 [cLEG-20-H2] Trace: SGN-T67390 EST: SGN-E252540 Direction: 5' Facility: TIGR
Clone: SGN-C180673 [TUS-34-P15] Trace: SGN-T187109 EST: SGN-E375207 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375208Length: 704 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375208 [] (trimmed) AAAACCTAGTTCAATTAATATATTGTGATTCTGTTTTACTTCCTTGGTTTAGACTTAATTTGGATCTGTAGTTTTATCAGTACATTCTGATTCTG
TTTTACTTCCCCAATTAATTTGCATCTGAAGTTTGATCAGAATCCCCAAATTCATGTTTTTGCTAATTAGGTTAAGCCGTTTGATTGACTTACTA
TTTTGTTGTAATTGTTGGTTACAATTACAGTAATTTCAGTTTAGATGGCTAATACAGCTTCTATCAGAACAAATAACTCAGCCTTCACTGCTATG
ATTCACTATATAACCTTTCACTAATTACCAATATGCTTTTATATCTATCTTTACAATTTGAATTTGTTACCTAAAATGCGTGGAGGTCAGGATTA
GGTTAGAAGGTTAGTAAGAGTATTCTTGCACTTTGTTATATTGTCTTCTATGGTTATTACTTTCCGTTGTTTCATTTTGTTTGAATCTTGTTGTT
TTGCTGTCATATTTCTTGCTACCATGCTTCGAGTCCTTTTCTTTTCTTGTCGAGCCATGGGTCTATCGAAAATAACTTCTCTACACTACAAAGTT
AAGGTCTACATCCTACCCTCACCGGAACTCACTTGTGGGATTACAGCGAGTATGTTGTTGTTGTTGAATGGATTCGTTGATGTAAATGATGGTGT
ATGAAACTGATAGTGTTATGAGATAGAATATGTTCTTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375208] SGN-U568589 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187110 [Download][View] Facility Assigned ID: FA0AAD22CH08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5