Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E374528

Search information 
Request: 374528Match: SGN-E374528
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182114Clone name: TUS-38-L16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182114 is on microarray TOM1 spot ID 1-1-1.4.10.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C84495 [cLET-29-A19] Trace: SGN-T109648 EST: SGN-E297233 Direction: 5' Facility: TIGR
Clone: SGN-C182114 [TUS-38-L16] Trace: SGN-T187797 EST: SGN-E374527 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374528Length: 305 bp (919 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E374528 [] (trimmed) TTCAATGCTCTTGCCATTAGGAGGTTGAAGGAGATTCAGTGCTATAGAGGAGTAAGGCACATCCAAGGATTGCCTTGCAGAGGACAACGAACAAA
GAACAATTGCCGTACTTTGAAGGGCAAGAAAGTAGCAATTGCAGGGAAGAAGAAGGCACCTCGTTAAATCAAGATCGATTTTTCATTTCTTTTGG
TAACTAACTTGTAAAAGTTACACTCTATATTCCTATGGCAAACTGTGCATTTGTTTGTTATAAACAGTTTTTTCCATTGAAATCATTTTTCTACA
TTTCAAGATAAGAGCTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374528] SGN-U566487 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187798 [Download][View] Facility Assigned ID: FA0AAD26DF08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5