Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E373025

Search information 
Request: 373025Match: SGN-E373025
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179853Clone name: TUS-32-N11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179853 is on microarray TOM1 spot ID 1-1-6.2.1.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86764 [cLET-44-D20] Trace: SGN-T111495 EST: SGN-E298859 Direction: 5' Facility: TIGR
Clone: SGN-C179853 [TUS-32-N11] Trace: SGN-T186177 EST: SGN-E373024 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373025Length: 619 bp (920 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373025 [] (trimmed) GTAAGTTTGAGAAACGTCTAGTCTAGAGAGAAATGGCAAATCCAAAGGTTTTCTTTGACCTTACCATCGGTGGTGCACCAGCTGGTCGTGTGGTG
ATGGAGCTCTTCGCCGATACCACTCCCAAAACCGCTGAGAACTTCCGAGCTCTTTGTACCGGTGAGAAAGGTGTTGGAAAGATGGGGAAGCCTTT
GCACTACAAGGGCTCAACCTTCCACCGTGTGATCCCAGGGTTCATGTGTCAAGGAGGTGATTTCACCGCCGGAAACGGGACCGGAGGAGAGTCGA
TCTATGGAGCCAAATTCAACGATGAGAACTTCGTTAAGAAGCACACCGGCCCTGGAATCCTCTCCATGGCTAATGCTGGACCTGGAACCAACGGT
TCTCAGTTTTTCATCTGTACCGCTAAGACTGAGTGGCTCAACGGAAAGCACGTCGTGTTTGGACAAGTTGTTGAAGGCATGGATGTGATTAAGAA
GGCAGAGGCTGTTGGATCTAGCTCTGGAAGGTGCTCCAAGCCTGTGGTTATTGCTGACTGCGGTCAACTCTAGATCTGATGATGATGATGATCTA
GTTTTATCAGTCTTTTATGTATTTGAGTCGCCGTTTTAGGCTTTGTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373025] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186178 [Download][View] Facility Assigned ID: FA0AAD20CG06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5