EST details — SGN-C37297

Search information 
Request: 37297Match: SGN-C37297
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C37297Clone name: cLEG-41-K16
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177366 is on microarray TOM1: SGN-S1-1-5.2.6.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177366 [TUS-26-F20] Trace: SGN-T182643 EST: SGN-E370029 Direction: 3' Facility: INRA
Clone: SGN-C177366 [TUS-26-F20] Trace: SGN-T182644 EST: SGN-E370030 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259074Length: 415 bp (851 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259074 [] (trimmed) GACAAATAATTTAATATATTTATTTTGTATAACTGTAACATACTTTTGTTGGAGTTCGTATAGTTGAAAATTCCTTTACAAGTATAACTGGTTGC
TACTCTTCCTTTATATACAGTCGCCCTACACCATATAACCTATATTGCTTGCTTCTATACTTGTCAAACAGAACTCAGGTTTCACTGAACAAAAC
TTTCTTCCCCAAGCATTCAACAGCTGGGCAACTACTCTTCACCAGGCCACTAAATTAGCATTCTAGAAACTGTTTGTTCTCTGACCAACTGCAGC
CCGTGGACCATCCCAAAACACCCAGGATCATGTCAATCCTCGAACTTGCACCAACCAAGCTCTCTAGGTTGGCTTCAATATGAAATAGCGCGACA
CCGATTCCCTTCCCTCTATCCGTCTCAGCCGCACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259074] SGN-U578166 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72106 [Download][View] Facility Assigned ID: TBFGF68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5