EST details — SGN-E372899

Search information 
Request: 372899Match: SGN-E372899
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179655Clone name: TUS-32-F5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179655 is on microarray TOM1 spot ID 1-1-4.2.1.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80139 [cLET-11-F5] Trace: SGN-T105173 EST: SGN-E292710 Direction: 5' Facility: TIGR
Clone: SGN-C179655 [TUS-32-F5] Trace: SGN-T186053 EST: SGN-E372900 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372899Length: 556 bp (908 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372899 [] (trimmed) GTACCAGTGGAATGACCCAACTGAATCCAGTCCGCGCCATTTATTATTGAAGGACTTGAATCTTAATGATAGATAGATATTACTAACCCCATTAA
ACAAACAACATAAAGGCTTTGGTCATGTTCAAAGCCCTTTGAGAAGGATGCATCCTCCAAAAATTGAAAGAAATTTAAAACGAAAAGAAAGAACA
AAATCGCGATAAATGACTAATCTGATTGCAAATCATCCTTTTAATCATTCACAAATCCAGGATCTGTAATTATATTCTCCAATTCTTTACCTTTT
TCATCATTGAAGCCCAGTGCATCCAATACCTTATAACCTGGTGATCCTTGTTGTGCCCACACTCCAAGGAGCACATGAGTAGTTGTAATCTCCCC
ACCGTTACCGGATTTGAGTTTTTCATCAAATGCCCAATCTAAAGCCTTTTGCCCGTCTTCAGTCAAAGGAGGTTCCTTGGGACTGCAATGGAATA
CGTCCCCTTTTCCAAGTATTTTTATAGTTTCTTCACGAAATTTCAAGAGAGTAATACTGTTTGCCATTAAATATTTTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372899] SGN-U569614 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186052 [Download][View] Facility Assigned ID: FA0AAD20CC03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5