EST details — SGN-E372782

Search information 
Request: 372782Match: SGN-E372782
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179850Clone name: TUS-32-N8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179850 is on microarray TOM1 spot ID 1-1-1.2.1.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86757 [cLET-44-D12] Trace: SGN-T111357 EST: SGN-E298721 Direction: 5' Facility: TIGR
Clone: SGN-C179850 [TUS-32-N8] Trace: SGN-T186264 EST: SGN-E372783 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372782Length: 363 bp (864 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372782 [] (trimmed) CAAAACATTACATCATGACCAACCATTCATAGTACGTAAATGAATGGCTTTATTCATACTTGTTACAAGCAAAGGGTCTTAATTAAGTAGCAAGA
TTATTATTATCTTGTCACTTAATTTCAAAAGTTTACAATAATAATAAATACACATAATTAAGCACTAATTAATTATTTAGTTTTGAGTCTGGGCA
GCAACATATTCTTCATAAGAGCAGCAGTATTTTTTGCATCCATATTTGTATTTTTTGCAGCAACTGTAACATTTCTTACGTTTGCCATAGCCCTT
GCCATAATAATGATCGACGTTTACTGCATTCTCGTTATCCAATTTCACCGCATTGGTAGTCTCAGCTGCCCCTGCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372782] SGN-U578947 Tomato 200607 Build 2 200 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186263 [Download][View] Facility Assigned ID: FA0AAD20DG04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5