EST details — SGN-E372665

Search information 
Request: 372665Match: SGN-E372665
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179303Clone name: TUS-31-G13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179303 is on microarray TOM1 spot ID 1-1-4.3.2.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77298 [cLES-20-I19] Trace: SGN-T102182 EST: SGN-E290503 Direction: 5' Facility: TIGR
Clone: SGN-C179303 [TUS-31-G13] Trace: SGN-T185121 EST: SGN-E372664 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372665Length: 440 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E372665 [] (trimmed) GCAACAATGGCTTCACCATGATGACTACTCTACCACAGTTCAATGGACTCAAACCCCAACCTTTCTCAGCTTCTCCAATTCAAGGCTTGGTGGCA
ATTCAACCAAGACGCAACAAAGGACAAGGTGGTTTGGGAGCTCGTTGTGATTTCATTGGCTCATCCACTAATTTGATAATGGTGACATCAACAAG
CCTGATGTTGTTTGCTGGTAGATTTGGTCTAGCACCATCAGCAAACAGGAAGGCAACTGCAGGGCTAAAACTTGAAGTGAGGGACTCTGGGTTAC
AGACAGGGGACCCTGCTGGATTTACACTTGCTGATACTTTGGCTTGTGGTACTGTGGGTCATATTATTGGTGTTGGAGTTGTTCTTGGACTCAAA
AACATTGGTGCTCTCTAAAATTTGTATTACTCCTTATGTTTATAAGAAAAACAAATCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372665] SGN-U575975 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185122 [Download][View] Facility Assigned ID: FA0AAD19AD07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5