EST details — SGN-E372575

Search information 
Request: 372575Match: SGN-E372575
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179297Clone name: TUS-31-G7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179297 is on microarray TOM1 spot ID 1-1-2.3.2.8 [Order] [Tomato Microarray Database]
See unigene SGN-U580309 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C77281 [cLES-20-H23] Trace: SGN-T102260 EST: SGN-E290581 Direction: 5' Facility: TIGR
Clone: SGN-C179297 [TUS-31-G7] Trace: SGN-T185033 EST: SGN-E372576 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372575Length: 294 bp (917 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372575 [] (trimmed) AGGCAAGAGGAAGAATTGGAAAAGTAAGACCTATATGTCCAAGTTTGGAATGGTCGAGCGAGGTGTGTAATTGTGATGCATTACAACTCCAAAAA
AAGAAAAAAAAGAATCGTCTAATAACGGAGCATGTAGGTTCTGCGTCTGAACCAGTTATAATCAGGTAGTGTCTGGATAGGCCCCAGCGCGGATA
TAGCAACATCCTGGTCAAAGATAAATCTGTTTGCAACTCGTTTGATGGTGCTAGCATCCACAGCATCAACCCTTGCAAACAGCTCTGTAGCTGGA
ATCCTTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372575] SGN-U580309 Tomato 200607 Build 2 67 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185032 [Download][View] Facility Assigned ID: FA0AAD19AD04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0004 Quality Trim Threshold: 12.5