EST details — SGN-E372468

Search information 
Request: 372468Match: SGN-E372468
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179554Clone name: TUS-32-A24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179554 is on microarray TOM1 spot ID 1-1-1.1.1.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82397 [cLET-1-M5] Trace: SGN-T102403 EST: SGN-E292129 Direction: 5' Facility: TIGR
Clone: SGN-C82397 [cLET-1-M5] Trace: SGN-T102404 EST: SGN-E292130 Direction: 3' Facility: TIGR
Clone: SGN-C179554 [TUS-32-A24] Trace: SGN-T185964 EST: SGN-E372469 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372468Length: 500 bp (854 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372468 [] (trimmed) CGGCGTAATTTTTATAATTACAGAGTAAAAAGGACAAATTATTGTATACAAGATCTTACCCTCACCTTTTGTGAGGTAAATATGCTATTTCTGAT
AGACCTTCTCCTCTAACTAATGATTCAAGACATTAAAAAAAAACTATATTTAAGTAATGTAGTTTATATTATTACAACTCTATAAATTATAATTA
CAGTGTTAATATAAAACTTGAAACCCCAACAATTTTGACAATTAAAGTAATGTAGGTAGTGTGTTTAAATTAGGACAATATGAACTTTTTCTAGT
CTCTGGAAGTCCTATAAAGAGCTCTGTCTCAACTTCCATTATTTGTCTTTCAACATCTTTCTCTACTAGAGGAACTGGTGTTAAAGTCAATGGTA
GCACCTGACACTTTTTTTTCAAGTCTACATTTTCCTTCAATAGAATTTTTTCCTCTTCCTTCAGTTGAGCAATCTGTTCCTTGAATAACAGATTC
TTTCTTGCCCTAATGTTGCTTAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372468] SGN-U582357 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185963 [Download][View] Facility Assigned ID: FA0AAD20BA12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0004 Quality Trim Threshold: 12.5