EST details — SGN-E372275

Search information 
Request: 372275Match: SGN-E372275
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179081Clone name: TUS-30-N7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179081 is on microarray TOM1 spot ID 1-1-2.2.3.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78756 [cLES-6-K24] Trace: SGN-T98591 EST: SGN-E287139 Direction: 5' Facility: TIGR
Clone: SGN-C179081 [TUS-30-N7] Trace: SGN-T184716 EST: SGN-E372276 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372275Length: 483 bp (908 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372275 [] (trimmed) AAGTAAAAAGTTTCATTACTTCAATTTCTTTTGAAGTAGAAAAATGTTTCCTTAGTCTAACTAGTGTTTCTTCTAACTCTGAACTGTACAGTGTC
TATCCTGGTTTACTACAACTATACAAAATTATGTAACTAAAAAAATGGGGACTGGTTTCCTTCTCACTTCCGCAATCGAGATGTGAGATCGATGA
ACAAATCCTCGCTGCAGGGAATAGTCACACCACCCATTGGATGGTCGAAGCCAAATTCTTCCTCAGATTGACTAAGCAAGTCTTGAAATAAAGGT
TGGCTCAAGAATGATATCGGGATCACAAATCTCTTCTTCTGCATCTCCCCAACATACACAGCAAAATGACCCTTGGGAATATCTCTAGTTGCAGA
AGACTTCTTGATCATACGAAGAATAGCCATGATCTCTTAGTTTTAGTATAGGTGAGAAAAAAGGAAGGATTGTAAGGTTACCAAAAAGCAGAGAA
AGCTTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372275] SGN-U577967 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184715 [Download][View] Facility Assigned ID: FA0AAD18CG04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0003 Quality Trim Threshold: 12.5