Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E371645

Search information 
Request: 371645Match: SGN-E371645
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178484Clone name: TUS-29-E10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178484 is on microarray TOM1 spot ID 1-1-7.1.4.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72117 [cLER-1-D18] Trace: SGN-T92187 EST: SGN-E280633 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371645Length: 183 bp (927 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E371645 [] (trimmed) TCTGTACAATGAGGCATATGCTCATGTGAAGTAGAGTAGATTTTGATGTAATTTTTCGTTTTTATCAGAGCAACATCTTCAAATAAAATTCTGTA
TTTACCTTACAGTTCATTGTTACTTATAAATCATATACTAGTACATATTTCCTTTGTTTCTATGAATGCAACCGATTGTTTTGTTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371645] SGN-U578782 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183974 [Download][View] Facility Assigned ID: FA0AAD17BC05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.900 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5