EST details — SGN-E371526

Search information 
Request: 371526Match: SGN-E371526
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178664Clone name: TUS-29-L22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178664 is on microarray TOM1 spot ID 1-1-3.4.3.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72341 [cLER-1-O13] Trace: SGN-T92078 EST: SGN-E280524 Direction: 5' Facility: TIGR
Clone: SGN-C72341 [cLER-1-O13] Trace: SGN-T92079 EST: SGN-E280525 Direction: 3' Facility: TIGR
Clone: SGN-C178664 [TUS-29-L22] Trace: SGN-T184294 EST: SGN-E371527 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371526Length: 292 bp (837 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E371526 [] (trimmed) AAATCAAAGAAGCATTTTGCACTGCTATATATCGATATATTCCGAACAAGCAAATCTTTGCTGTTCTAATTTACACATTCTTGAATCAGAGTCAA
AGTCACAATATAAGTTACTACAACTTATTAGACATGAGAATGAAAGCCCAATGGAACGCAAAAACCAAAAGAGATTTAATGGCCAGGACTAGTAG
AAGCATTAACATTGTGTGAACTTCCAAGTTCTTCAGTGAAGCAATCTTGGCAAAGGCACGACTATGCCATAATTAATCAAGAATTTACAATTTCT
CCATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371526] SGN-U567552 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184293 [Download][View] Facility Assigned ID: FA0AAD17DF11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0007 Quality Trim Threshold: 12.5