EST details — SGN-E370496

Search information 
Request: 370496Match: SGN-E370496
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178535Clone name: TUS-29-G13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178535 is on microarray TOM1 spot ID 1-1-4.3.4.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72173 [cLER-1-G14] Trace: SGN-T91914 EST: SGN-E280360 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370496Length: 458 bp (910 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E370496 [] (trimmed) GAAAACGAGAAGAAAGGGCAAAGGTGGAAAACCCGACTTCATACCTTTCGCCGTCAAGCAACTCTTCGTTCTACTTCTTTCACCGTCCGCCGTGC
GCCGTCCGCCGTCACAACAGCATAGAGTGAGAAATGGCTTGCCTGCAATATGGTAGGAATACTCTCCGGCAACAGCTGAAGAATGTGAAAACCCC
AGCTGCTATCTTCCAGAATTGCGAAGGTGGAGAAGTACATTTACACCATCCACTATTTTACGCCGCCCAAGGTGTTCGATACAGAAAACTACAAG
TCATTCTCACTACTGGCATAGATAAGCTTGGAAAAGCAGGGGAAACTGTGAGAGTTGCACCTGGGTATTTTCGAAACCATCTTATGCCCAAATTG
CTGGCTGTACCCAATATTGACAAGTACAGGCATCTCATGGAAGATCAACGAAAGATTTACCATCGTGAGGAAGTTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370496] SGN-U574385 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183837 [Download][View] Facility Assigned ID: FA0AAD17AD07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5