EST details — SGN-E369649
| Search information |
| Request: 369649 | Match: SGN-E369649 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C177032 | Clone name: TUS-25-H22 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C177032 is on microarray TOM1 spot ID 1-1-3.4.8.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C28875 [cLEF-49-H4] | Trace: SGN-T62461 | EST: SGN-E248953 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C177032 [TUS-25-H22] | Trace: SGN-T182139 | EST: SGN-E369650 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E369649 | Length: 193 bp (916 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E369649 [] (trimmed)
TTCCCTTTTTTTTAAGTGCAAAAATAATAGAACTTTTTTCCTATTCTCTTTCCGGAGGGAGGAAGGGGGAAATGTGAACAATTGGGTATTAGGAG
GGAGACTTGACTTTGAATAGATGTGCTACGCTATAACAACCACCAAAAATTTATAATGCGAAGGAGGGTTCAGACATCCATCGCCCATACAGACG
TTT
GGAGACTTGACTTTGAATAGATGTGCTACGCTATAACAACCACCAAAAATTTATAATGCGAAGGAGGGTTCAGACATCCATCGCCCATACAGACG
TTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E369649] | SGN-U592936 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T182138 [Download][View] | Facility Assigned ID: FA0AAD13DD11FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.902 | Expected Error Rate: 0.0121 | Quality Trim Threshold: 14.5 |


