EST details — SGN-E368635

Search information 
Request: 368635Match: SGN-E368635
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175774Clone name: TUS-22-D12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175774 is on microarray TOM1 spot ID 1-1-5.4.11.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16752 [cLED-17-H4] Trace: SGN-T53039 EST: SGN-E238597 Direction: 5' Facility: TIGR
Clone: SGN-C175774 [TUS-22-D12] Trace: SGN-T180818 EST: SGN-E368636 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368635Length: 326 bp (936 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E368635 [] (trimmed) GATTGATAAACGGAGAAGTGATACAGTAAAGTCCTTGAACATACAATCAGCAAGAAAATGGAATTAGAAGTTAATTATTATTAATCTAAATAAAA
TGTTCTCCATAATTAGGTAGTGGCTGGGTCAAGAAGGATATCATCATCAAATTAAAAGATGATAACAAGGTAATTTCTATTTCCACAGCTAGCTA
GAGTATTATTATTATTTTCTAGCTCATGATGAACTTCTTCCAATTCTCAATGAAGAGTCAACTGATCCTTTGGTAATACTAGCAAAGAGCTTAGC
AATCTCAAGCTGAGTGTTGGCAATGATCTCCGTTCTCTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368635] SGN-U564532 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180817 [Download][View] Facility Assigned ID: FA0AAD10DB06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0059 Quality Trim Threshold: 12.5