EST details — SGN-E368628

Search information 
Request: 368628Match: SGN-E368628
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175732Clone name: TUS-22-B18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175732 is on microarray TOM1 spot ID 1-1-7.2.11.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16656 [cLED-17-D11] Trace: SGN-T52993 EST: SGN-E238551 Direction: 5' Facility: TIGR
Clone: SGN-C175732 [TUS-22-B18] Trace: SGN-T180811 EST: SGN-E368629 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368628Length: 537 bp (913 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E368628 [] (trimmed) AAGTAAAGAGGGAGAGCTATCTTAGATTTTAACTCAAAACACCAAGTCATCAGGCATTATACAACGCAGAAGTTGGTCCTGCATCTTTGTTGGCA
GCAAACAGGAGCACTAAAGATGAACGAACAGGTAATAAAATCTTAGTGGACAGCATGAATCATCAAATTGAGTACACGGGGTAACTAAATGGCAA
ATAGCAATGTCACTTCATTCCTGCCAATGCTTGATTGTTTGTACCAAAGAAAATGTAGTACAACTAATTGTAGACCATATACTTTGGTGTTGCAC
TGAATTTCTGATATCCCTTAATGACCTTGTTAACGGCATCCAGAAAGTCTTTCTCTGTAACAGTTTTCCTCCTTGCTCGAATAGCATACATTCCA
GCCTCCGTGCACACACTTCTTATATCAGCTCCTGTAGAGTTTGGACAGAGACGTGCCAAAAGTTCAAATCGAATATCGCGCTCACAATTCATTGT
CCGTGTATGAATCTTAAATATCTGGGTTCTACTCTCTAGATCAGGTAGACCAAACTCAACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368628] SGN-U570780 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180810 [Download][View] Facility Assigned ID: FA0AAD10DA09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5