EST details — SGN-E368524

Search information 
Request: 368524Match: SGN-E368524
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176340Clone name: TUS-23-L2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176340 is on microarray TOM1 spot ID 1-1-7.4.11.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26508 [cLEF-40-K17] Trace: SGN-T59947 EST: SGN-E246095 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368524Length: 370 bp (902 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E368524 [] (trimmed) TTGACCAAATGGTCACTATACAGAGCAGCAATAGCGGAGTTCATTGCTACTCTGTTATTTCTATATATAACTATTCTTACAGTAATTGGTTACAA
ACATCAAGCTGATGTTAAAGCCGGAGGCGATATTTGCGGTGGTGTTGGTTTACTTGGTATTGCTTGGGCTTTTGGTGGCATGATCTTTGTTCTTG
TTTACTGTACTGCTGGTATTTCTGGTGGACACATCAACCCTGCTGTGACATTTGGGCTATTTTTGGCAAGGAAGGTGTCATTGATTAGGGCTATA
TTGTACATGGTAGCACAATGTTTGGGTGCAATTTGTGGTGTAGGTTTTGTTAAGGCTTTTCAAAGTGCATACTACAATAGATATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368524] SGN-U580272 Tomato 200607 Build 2 181 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181451 [Download][View] Facility Assigned ID: FA0AAD11DF01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5