EST details — SGN-C36753

Search information 
Request: 36753Match: SGN-C36753
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C36753Clone name: cLEG-39-O6
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C181031 is on microarray TOM1: SGN-S1-1-4.3.17.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181031 [TUS-35-O13] Trace: SGN-T187440 EST: SGN-E375672 Direction: 3' Facility: INRA
Clone: SGN-C181031 [TUS-35-O13] Trace: SGN-T187441 EST: SGN-E375673 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E257847Length: 547 bp (1071 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E257847 [] (trimmed) GTTGAATGCTACCTATATCATCAGTGTTGCACGGAAACTTGGGTGTTCTATCTTTCTGTTGCCTGAGGATATGGTGGAGGTTAACCAAAAGATGA
TCCTCACTCTCACTGCCAGCATCATGTACTGGAGCCTTCAGCAGACAGCGGACGATATAGAGTCTCCTGCGAGTACTGTTGCATCTGATGCATCA
CCAGCAAGATCTATGAATGGCTCTATGTCCCCCTATACTGCTGCTTCACCTGATGCATACCCTGCACCTTCAATTAGTGGAGCATCATCAGCTAC
TCCTGACGCATCTCCAGCACCATCTGTAAACGGAGATGAGGAAAGCCCACTTATTACTGAAGTGTCAAAGTTGGAGTTGGTTGCTGACTATGCAC
CATCTGATACTCCTGAAGTGTCAAAGTCGAAGTTGGCTGCTGATGATGCACCATTTGATGCCACTGAAGTTTCAAAGTTGAAGTTGGCTGCTAAC
GACACTCCATCTGATACTACTGAAGTGTCAAAAGTGGAGTTGACTGCTGATGACGCACCATCTGATACTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E257847] SGN-U578987 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T71533 [Download][View] Facility Assigned ID: TBFFX87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0117 Quality Trim Threshold: 14.5