EST details — SGN-E364118

Search information 
Request: 364118Match: SGN-E364118
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105021Clone name: cLPP-16-M9
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194743 [TUS-71-J21] Trace: SGN-T348508 EST: SGN-E547633 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194743 [TUS-71-J21] Trace: SGN-T348509 EST: SGN-E547634 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E364118Length: 172 bp (862 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E364118 [] (trimmed) CACCATGGCAGATAATCAGCAACCTATTTTGCAAAAAGATGATGCACAACATCCGATGGCAAAGCTGAACCGTCTGCACTTTTGGCTTTTGGTGG
CACTCAACATTGTTTTCCTTCTCGTTGGTCAAGCTGCTGCTGTAATTTTGGGAAGATTTTACTATGAGAAGGGTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E364118] SGN-U583724 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T176500 [Download][View] Facility Assigned ID: TPOCI77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0208 Quality Trim Threshold: 20.5