EST details — SGN-E360226

Search information 
Request: 360226Match: SGN-E360226
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C104571Clone name: cLPP-14-K10
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194684 [TUS-71-H10] Trace: SGN-T348407 EST: SGN-E547532 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194684 [TUS-71-H10] Trace: SGN-T350426 EST: SGN-E549551 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E360226Length: 305 bp (986 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E360226 [] (trimmed) GGAAGAAGAAGACGAAGATATTTCCCTCTTCTTCTTTGTCAGAATTAAATAAAAAGTGGCCCCCAAAAAAAATATCCATATATTTTTTTTTAACG
GAGAACTATTGCGGTCATTGGGAAAAAAAAAAAATGAATGTGGAGAGAACAAGTATCACTGTTGTGTCTTTGCTAGTTTGCCTTTCATTTGTGTT
GGTTAAAGCTGAAGATCCTTACCTACGTTTTGAGTGGAATGTCACTTATGGAACTATCGCTCCGTTAGGGGTCCCACAACAAGGGATTCTTATAA
ATGGACACCTACCGGGACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E360226] SGN-U593666 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174432 [Download][View] Facility Assigned ID: TPOCB65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0233 Quality Trim Threshold: 14.5