Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E358979

Search information 
Request: 358979Match: SGN-E358979
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102243Clone name: cLHT-24-D16
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: Alias clone SGN-C184887 is on microarray TOM1: SGN-S1-1-4.4.14.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184887 [TUS-45-P5] Trace: SGN-T198750 EST: SGN-E397424 Direction: 3' Facility: INRA
Clone: SGN-C184887 [TUS-45-P5] Trace: SGN-T198751 EST: SGN-E397425 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E358979Length: 456 bp (902 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E358979 [] (trimmed) TTGCATCTACCATCAGCTCAAATCCCAGCCTGTGTGGCTTCTTTTGCTTCTTTCTTTAGGTTTCTTGAAAGTCTTGTGCTTTTCAGTCATCTTTC
TCAAATGGGTCTATGTCAATTTCCTCAGACCTGCTAAGAATCTTAAGAAATATGGGTCATGGGCACTTGTTACTGGACCTACAGATGGTATTGGG
AAGGGCTTTGCTTTTGAATTAGCTCGAAAAGGGCTTAATTTAGTTCTTGTGGGTCGTAACCCTGATAAACTTAAGGATGTTTCTGAATCGATCAA
AGCTAAATATGGACAGACCCAGATCAAAACAGTCGTCGTTGATTTCTCTGGTGATTTGGATGAAGGGGTTAAGAAGATTAAGGAGACAATTGAAG
GATTGGAGATTGGGGTTTTGATTAATAATGTTGGGGTTTCGTATCCTTATGCTAGATTTTTTCATGAAGTGGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E358979] SGN-U579116 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170539 [Download][View] Facility Assigned ID: THTDR20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5