Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E347666

Search information 
Request: 347666Match: SGN-E347666
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C144546Clone name: cTOF-26-L12
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181620 is on microarray TOM1: SGN-S1-1-7.4.12.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181620 [TUS-37-H2] Trace: SGN-T194391 EST: SGN-E393065 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E347666Length: 471 bp (931 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E347666 [] (trimmed) GGGAGGTTGTAGTCACCGTGAGGTCGCCACTGAATGCTGAACAAAAGATGAGTACTCTAGAGTCTCTAATCAACTATGGGAAGAAACTGAGGAAG
ATGAGAATAAGAATTCTTCAGATGAAGAGCAGCCATAGCAGTACAGATGATTTTTTTGAGGATATTTGCAAATTCACTCACAGTCATCGCAGGAT
TGTTTCAATTGAATAGAAAAGAGTAGCCCAGTGCACAAGGCATCCCGCGTTAGCAGGGTCCTCGGAAGGGCCGCACCCCATTTTTTCGATTGAAT
AACGATTGGATATTTCCTTGTTCTCTTTAATTTTAATAGGAACATACTTGGACCATTCACGTCATAGTTCCTAGACATTTTTACTTTGATTTATG
TACCTTCGAATTTTATAGCTAAGACTTGGAGCTCAGATGTTTTAAACTCATGAGTACTTTGAGGAAATCATATATGAATTTCTTTGGTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E347666] SGN-U567906 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T159538 [Download][View] Facility Assigned ID: TOFDZ66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0100 Quality Trim Threshold: 12.5