Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-C3338

Search information 
Request: 3338Match: SGN-C3338
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C3338Clone name: cLEC-20-E13
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C185007 is on microarray TOM1: SGN-S1-1-4.1.12.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185007 [TUS-46-E5] Trace: SGN-T198901 EST: SGN-E397575 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205935Length: 514 bp (887 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205935 [] (trimmed) AAGAAATTAACACACTCCACAACCACAAGAGAGACTATCACCTGAGTCTTATTTATTATTATTATTTAGAAGCAACAACACAAACTACTTCTCCC
AAAAATATTATTACAACAGAAATAATGGGAAATTGTTGGCCAAAACCTGTGGATGTTGTTCCTCCCACCTCTAATACTCCTCCTCCAGTGATCAT
GAAGAAACCAATTAATACATCTCCGGGAAGTAACACAAGGAGTGTGGTGGCGCAGCCTAGCGGAGATGGCGGTGATTCGAGGAAAATGGAAGTTC
CGGCTAGCGGAAAAATAATTACGCCAAATTTAAAAATGTTTACGCTAGCGGAATTAAAGAGCGCGACGCGTAATTTTCGGCCCGATACGGTGCTA
GGTGAGGGAGGATTTGGTACAGTATTTAAAGGATGGGTCGATGACAAAACATTTGCACCTTCTAGAGTTGGAGTTGGTATGCCTGTTGCTGTTAA
AAAATCAAATGCAGACAGTGAACAAGGTCTTAAAGAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205935] SGN-U566665 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27717 [Download][View] Facility Assigned ID: TCACY31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0110 Quality Trim Threshold: 14.5