Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E319754

Search information 
Request: 319754Match: SGN-E319754
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C118245Clone name: cTOB-12-I24
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: Alias clone SGN-C182652 is on microarray TOM1: SGN-S1-1-7.3.6.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182652 [TUS-40-C2] Trace: SGN-T187828 EST: SGN-E375934 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E319754Length: 532 bp (833 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E319754 [] (trimmed) GGTAAGCTTCATCGATTCAGCTGATCGTTGCGTGTAGATACCTTTCTTCTTTCTTCAATTTAGGGTTTCGAGTTCCCAGGTTTTCCTATTTTGCA
GCTACTTTTAGGGTTTAATTTGGTTTGATAGCTCATTTCTGGGTTGAAAATGGCTGATGCATTCGAAGAGGATGGTGAGAATACTGTTTCAATTG
GAGAGTTTCTCCAAGATCTCGAAGAGCAGGAGCTGGAAGCAGGTCTGGTCTTAAGTGGTGATGAAGGCAAGGAGTGCACCTATAGTAAAGGTTAT
ATGAAGAGACAGGCTATTTTTTCTTGTTTGACATGCACACCGGATGGGATTGCTGGAGTATGCACAGCTTGTAGCCTTTCTTGCCATGATGGTCA
TGAGATTTTGGAACTTTGGACGAAGAGAAACTTTAGGTGTGACTGTGGAAATTCAAAGTTTGAGGAGTTCTTCTGCAAGCTTGATGCTAGCAAAG
ATGTTGAAAATACGAAGAATTCATATAATCACAATTTCAAAGGTTCATACTGCACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E319754] SGN-U574438 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T131621 [Download][View] Facility Assigned ID: TFBBT60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5