EST details — SGN-E311957

Search information 
Request: 311957Match: SGN-E311957
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C112383Clone name: cTOA-16-B18
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: Alias clone SGN-C182805 is on microarray TOM1: SGN-S1-1-6.1.5.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182805 [TUS-40-I11] Trace: SGN-T191594 EST: SGN-E390268 Direction: 3' Facility: INRA
Clone: SGN-C182805 [TUS-40-I11] Trace: SGN-T191595 EST: SGN-E390269 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311957Length: 460 bp (524 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311957 [] (trimmed) TTCGAGGCTCAAATTCAACCTCCAACTGGGGGAGATTTAATCACTGGTCTTACCATCGATGGAGGTGGTATTCGAGGAATTATTCCTGCTACTAT
CCTAAGTTTTCTCGAATCGCAACTTCAGGAATTGGATGGGAAGGAAGCAAGACTTGCGGATTATTTCGACGTGATTGCCGGAACGAGCACCGGTG
GCCTTGTAACGGCCATGCTAACGGCTCCAGATGAAAATAATCGTCCTCTTTATGCTGCTAAGGATATTACACCGTTTTATTTAGAGCATTGTCCA
AAAATATTTCCACAAAAGAAATGTGGTTTATTTGCTCCAATTGGGAATATTGTGCAAACTCTAATCGGACCAAAATATGATGGAAAATATTTGCA
TCAAGTCGTAAAGGAAAAATTGAAAGATACTCGTCTTAGTAATACTATTACTAATGTTGTTATTCCAACTTTTGATATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311957] SGN-U578602 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T126066 [Download][View] Facility Assigned ID: TFACL09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5