Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E311381

Search information 
Request: 311381Match: SGN-E311381
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99589Clone name: cLEZ-18-F22
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193563 [TUS-68-I17] Trace: SGN-T346481 EST: SGN-E545606 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193563 [TUS-68-I17] Trace: SGN-T346482 EST: SGN-E545607 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311381Length: 293 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311381 [] (trimmed) GGCAGAAGTGGTTGAATGTGCATGTGTGATTGAAATACCAGAACTAAAGGGTAAGGAGAAGTTGAATGGCAAGCCATTGTATGTGCTGGTGGAGT
ATCGGTAGTATCTGCAGACCAATTATGTTTATTGTTATAACAAACTGTACATTAGAGGGCGCTATTATTGGCCAACTTGTCTGGGTTATTTATCT
TTTCATTCTTCATTATGTGTAGTGAATTTTGAAAAAAAGGCCTCTTTGGTTTATGTGGAGAACTCATTCACGAGCTAAGGTGAAGAAAAATGGAT
TGTTCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311381] SGN-U578605 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123596 [Download][View] Facility Assigned ID: TRZCT35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0015 Quality Trim Threshold: 12.5