Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E308530

Search information 
Request: 308530Match: SGN-E308530
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97342Clone name: cLEY-21-B12
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193107 [TUS-67-F17] Trace: SGN-T345698 EST: SGN-E544823 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193107 [TUS-67-F17] Trace: SGN-T345699 EST: SGN-E544824 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308530Length: 254 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E308530 [] (trimmed) CGTGTTGCGCGGAAAGGGCGTGAAGGAGAAGAAGGCCTGGTTCTGCTCCCAGCTCGTCGCGCAAGCGTATATTGAGATGGGTCTGCTCAAGTGTC
CGCCCCTACCGTCGGTGTATGTGCCTGAGCGATTCGCGCACGACTGCGACATGAAGCTGCCCCTCCTCCAGGGCGCCGCCCTCGCTGACCCCATC
CGCCTCCCGAACAAGTTCTAGTCTAGCGCCGTGTATGTCTATTAATTAGATCGGATATAACTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308530] SGN-U565133 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120829 [Download][View] Facility Assigned ID: TRYDF06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0005 Quality Trim Threshold: 12.5