EST details — SGN-E305286

Search information 
Request: 305286Match: SGN-E305286
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93582Clone name: cLEX-15-B5
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192578 [TUS-65-P16] Trace: SGN-T344789 EST: SGN-E543914 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192578 [TUS-65-P16] Trace: SGN-T344790 EST: SGN-E543915 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305286Length: 516 bp (978 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305286 [] (trimmed) GGTTAGACGAAACCCTAGTTATCTCCTTTTCTCCTGAACACACAAAGTTCTTCTCGATCTCTCGCCATTTCGTTGATAGAGACATAGATATAGTT
ATTGTTATAGAGAAAGAAAGGAAATGTATAGAGATCGAGGTGGTGGTGGTTCTTCCAAATCGGAAATGGTTGGAGGTAAGCGAATAAACGATGCA
TTAGATAAGCAGTTGGACAAGTCTTTAGCGTCTACGTCAAGGGCGTTGAAGGACAAAACTGTTCCCTCTACATCTACAGTTACTGGAAAATTGCA
TCAGCGTCATCCTAATCATCATATGGATCATCAGCGTGACACTCTCTCTTCATCTACTCCCACCACAAAAAACAAGTGCTCCGATGAGGAATCTG
AATCAGACAGTGAAGAATCTGATGTTAGTGGTTCTGATGGAGATGACACATCATGGATTTCTTGGTTTTGTAACCTGCGTGGGAATGAGTTCTTT
TGTGAGGTTGATGATGACTACATTCAAGATGATTTTAATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305286] SGN-U580411 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117772 [Download][View] Facility Assigned ID: TRXCG03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5