EST details — SGN-E304174

Search information 
Request: 304174Match: SGN-E304174
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94957Clone name: cLEX-6-I7
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94957 [cLEX-6-I7] Trace: SGN-T116052 EST: SGN-E304034 Direction: 5' Facility: TIGR
Clone: SGN-C192272 [TUS-65-C22] Trace: SGN-T344264 EST: SGN-E543389 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C192272 [TUS-65-C22] Trace: SGN-T349745 EST: SGN-E548870 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304174Length: 407 bp (767 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E304174 [] (trimmed) CCTAAATGGTTGGATTAATGCACAGTCCATATTTGCCATTGAATTAGGAGCATAATTTAAGGGTGGAGTTAGTACAAACATTCAATTCTTCAAAG
CAACCTCACCTTAGCACAACAGTTCATGATACAAGAATGAGGGTGAACCAATTTCTTGGAAACATGGTAACAATATTAGGGGTCAAGAATTTACT
ACCCTTAGCTAAGTGCCAAGTGACCATATCAAAAATTTTCTCTTTCCGTTTCGATACACCAAATAATGGCACTCTACTTTAGTATCCTCCGGAAA
CCAGCTATCCTCTGATCTCCTTGTCCAAAAAATACAAGGCGCCTCTCCTTGTCAACAAAAACGTAATTGCCTTAAGAAGCAAATGCCATAAATCC
AAGAGAACATGTCAACTTATATACAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304174] SGN-U570318 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116192 [Download][View] Facility Assigned ID: TRXAU52TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5