EST details — SGN-E302506

Search information 
Request: 302506Match: SGN-E302506
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93881Clone name: cLEX-1-A23
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93881 [cLEX-1-A23] Trace: SGN-T115090 EST: SGN-E302507 Direction: 3' Facility: TIGR
Clone: SGN-C192060 [TUS-64-K2] Trace: SGN-T343900 EST: SGN-E543025 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C192060 [TUS-64-K2] Trace: SGN-T349685 EST: SGN-E548810 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302506Length: 543 bp (917 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E302506 [] (trimmed) ATCACAAGGTTCAATGAGCCACACCAGCACCACCGCTGGCGGCGCCGGCGGTGGTCTCACTCGCTACGGTTCAGCTCCGGGATCATTTTTAACTA
CAGCAGTTGAAGCCGTCGTTAACGGTAATCACGAGTTCGCTTCTCACGGATCTCATCACTCACACCTTGGTCCTTCACGGTTTTTTCAGTCCAAT
CTAGCATCTACTTCGTTAAATTCCGAATCTACAAGTAAAGCGAAGGAACAATCGAATTTACAGAGGTCAATTGGTTTCAATGACTTAACAATCGG
CGGCGGAAGCGGCGCTGGAGGAGGAGTTTTGCCGACGACTTCAACGACGCCGTTGGTTCGACATAGTAGCTCACCGGCGAGGTTCCTTAATCAAC
TTGCTACTGCTGCAGGTGATACTGTTTCAATGGGGAGAGGAAGCTATAACCCAAAAGGCGGTGGAGATAGTGGCCGGGGAATAACAAGGCTGAAC
TCTCAGCTCAGCTTCACAACGCAAGAAGCTCTTTCTCAAATAGCAGAGGAAAATGAGGATATTGAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302506] SGN-U574134 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115089 [Download][View] Facility Assigned ID: TRXAA12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5