Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E298896

Search information 
Request: 298896Match: SGN-E298896
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86998Clone name: cLET-44-P6
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179950 [TUS-33-B12] Trace: SGN-T186951 EST: SGN-E374337 Direction: 3' Facility: INRA
Clone: SGN-C179950 [TUS-33-B12] Trace: SGN-T186952 EST: SGN-E374338 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298896Length: 562 bp (946 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298896 [] (trimmed) AGCGGACTTTTTGGGTCGTAGGGAGATCAGCTCTAGCCCCCCCCCCCCCCCCCCCCGAAAAAAAACAACTTACCTCAACGCTAAGCAACCATCGA
TAATCATCCCATAAGGTTACTAAATAACTAAACCCCAAGAACGCCCAAGACCCCTACCCCTTGGGAATAAAGCCCGCGGTGAAAGTTTAAGTGCC
GCCGCCAATGGGGCTCGTAAGGCGGCTAGTAAGGCCCCTTAACGGATTTCCCTTGGCAATAACGGTCCGAATGAAGAACTTAAATACTGAGAATA
CAGTAAGCTCGTTGCCTCCAACTCTTCCCATTCCGAGTCTGGTAAACGTTCTAGGGCTCCTAGTAAGGTTCAACGGGCTGAAGTCGTTATTGGGG
CAGAGCGGGCTGATAATTCTATTAAGAGGCGTATTAGTAACGTGGCAATTCCTAATGGTCTTTACTAATATAATCCGATAAGTTTAGACGGTTAA
GACGTCCCGCGTACGGATTAAGTCCGGGCCGTTTAAGCAGCTAAGCTTATTTCTGTCGAAGACTCGGGACTTGGTTCCGAATTATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298896] SGN-U598392 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111532 [Download][View] Facility Assigned ID: TMEGT87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0033 Quality Trim Threshold: 20.5