EST details — SGN-E298886

Search information 
Request: 298886Match: SGN-E298886
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86921Clone name: cLET-44-L22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179919 [TUS-33-A5] Trace: SGN-T1576 EST: SGN-E378188 Direction: 5' Facility: Giov. Lab
Clone: SGN-C179919 [TUS-33-A5] Trace: SGN-T186447 EST: SGN-E373995 Direction: 3' Facility: INRA
Clone: SGN-C179919 [TUS-33-A5] Trace: SGN-T186448 EST: SGN-E373996 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298886Length: 419 bp (932 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298886 [] (trimmed) GACTTTTTGGGTCGTAGGCGTCTAAGTAAAAGCGGCACCCTACTGGCCCTATAAGTTCCGTCCGCGAAGTTGACGAAGACCAACGGCTACGGAAC
GGGAAAGGACAACAAGAGGACGAAAGCGAAACGCACGGTAGTCAGCACCTTAGTAGACGACAGAGCGTTCGACACGGAGAAAAGGAACTCCACGA
ACCCGTCCCCACCGGGCGTATCCGTCCCATTAATCGGCGGAACGTCCGCATTCCACGTCATCCCTCCCGTATTCTTCGGTCTAGGAGGCGGCAGC
GGCGGCATTTTCGTTAAAGACGTCAACGGTAACGACGCCGCCGCGATCGAACGGTCTAAAATCTACGTATTCGGAATCTGAATTTCTATATAAGG
ATCAAAGGGAGACTTCATCCATTCCGCCGCGGAGAATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298886] SGN-U603477 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111522 [Download][View] Facility Assigned ID: TMEGT71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0071 Quality Trim Threshold: 20.5