Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E297541

Search information 
Request: 297541Match: SGN-E297541
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84478Clone name: cLET-28-P16
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184780 is on microarray TOM1: SGN-S1-1-7.3.14.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184780 [TUS-45-K18] Trace: SGN-T196566 EST: SGN-E395240 Direction: 5' Facility: INRA
Clone: SGN-C184780 [TUS-45-K18] Trace: SGN-T198630 EST: SGN-E397304 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E297541Length: 502 bp (933 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E297541 [] (trimmed) CGGGACCGGAGGAGAGTCGATCTATGGAGCCAAATTCAACGATGAGAACTTCGTTAAGAAGCACACCGGCCCTGGAATCCTCTCCATGGCTAATG
CTGGACCTGGAACCAACGGTTCTCAGTTTTTCATCTGTACCGCTAAGACTGAGTGGCTCAACGGAAAGCACGTCGTGTTTGGACAAGTTGTTGAA
GGCATGGATGTGATTAAGAAGGCAGAGGCTGTTGGATCTAGCTCTGGAAGGTGCTCCAAGCCTGTGGTTATTGCTGACTGCGGTCAACTCTAGAT
CTGATGATGATGATGATCTAGTTTTATCAGTCTTTTATGTATTTGAGTCGCCGTTTTAGGCTTTGTTTTTAATTTCAAACTATCTCTACTGCTTT
GGTCGGGTCGTGTCGGGTCGAGTTCTAGGGTTAACCGTAATTGGTTGTTGTGTTGCTTCTACCAGTTTATGTTTAATCTTAAGACTACAATTAAA
TAAGATACTCATAGACTTGCTAATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E297541] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109335 [Download][View] Facility Assigned ID: TMEEH92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0012 Quality Trim Threshold: 12.5