Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E297103

Search information 
Request: 297103Match: SGN-E297103
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91526Clone name: cLEW-2-G17
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191367 [TUS-62-N5] Trace: SGN-T342703 EST: SGN-E541828 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191367 [TUS-62-N5] Trace: SGN-T342706 EST: SGN-E541831 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E297103Length: 455 bp (806 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E297103 [] (trimmed) GAAATGCAGCACTTGAGCATACAAGTGTTGCAAGCACAACAGTCCTATCTTCTACGTCGGGATTATTCACCCTTTTTGTTGGTGTAATACTTGGT
GAAGATTCCTTAAATATGGCCAAAGTAGTTGCAGTCTTTGTTAGCATGTCTGGCGTTGTCATGACCACTCTAGGAAAAACATGGGCGACAGATGA
ATCTCAGTTAAATTCATCCTCGGTGTTGACTGATAGTTAAACTTTTTGTTTATTTTAAAGAAGTGGTGAACGTTCTCTCCTTGGGGACCTCTTTG
GCCTTCTATCACCAATGTCGTATGGGTTGTTCACTGTGCTGCTTAAAAAGTTCGCTGGTGAGGAAGGAAAAGGAATAGATATGCAAAAATTGTTC
GGTTATATAGGGTTGGGTACCCTTGTGACCATGTGGTGGCTTGTATGGCCGTTGACTGCGCTGGGGATTGAACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E297103] SGN-U567884 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T112188 [Download][View] Facility Assigned ID: TRDAE45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0176 Quality Trim Threshold: 14.5