EST details — SGN-E297048

Search information 
Request: 297048Match: SGN-E297048
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91635Clone name: cLEW-7-N3
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191389 [TUS-62-O3] Trace: SGN-T342741 EST: SGN-E541866 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191389 [TUS-62-O3] Trace: SGN-T349495 EST: SGN-E548620 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E297048Length: 481 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E297048 [] (trimmed) GGTGAACTTATATTAAGCATTATTTCATCATGGGATGGGCAAAATATGCCAGAGGAAAGCTATCTTTGCCTGTAATAACAGGAATTTTCTGTGCA
CTAACATTCATTGTTTTATTGTACACTGAAAGGATCACTACTTCTTCTTCTGGTTTCCATTTCGGGATCAAAACTTGTCCGAGACGAAATGCTGC
AAAGTTAAAAAAACATCATACAGGTGTTATTAGAAAGTTGAAGAGCACTCCACTATACAATCCAACAGATGATAGGTTCGTGTTTGATCCCAAGG
AATGCAACCTCAATAACGGGAAATGGGTGTTTAATACTACTATTAAGCCACTATACACAGATCGAACTTGTTCATATATTGACAGACAATATTCT
TGCACTAAGAATGGTCTAGACGATTCAGATTATCTTCACTGGGAATGGCCGCCTGATGACTGCATCTTGCCAAGGTTTGATCCGACGATTGCCCT
TATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E297048] SGN-U566241 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T112275 [Download][View] Facility Assigned ID: TRDBA74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0249 Quality Trim Threshold: 14.5