Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E295431

Search information 
Request: 295431Match: SGN-E295431
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83077Clone name: cLET-23-D24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184755 is on microarray TOM1: SGN-S1-1-8.2.14.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184755 [TUS-45-J17] Trace: SGN-T198716 EST: SGN-E397390 Direction: 3' Facility: INRA
Clone: SGN-C184755 [TUS-45-J17] Trace: SGN-T198717 EST: SGN-E397391 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295431Length: 469 bp (838 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295431 [] (trimmed) TGGAAAAAATGGCAACCGTGACAACACAAGCTTCCGCCGCCATTTTCCGGCCGTGTGCTTCAAGAACCAGGTTCCTTACTGGATCATCTGGAAAG
TTAAACAGGGAGGTCTCTTTTAGACCTTCAACTTCTTCGTCTTACAACTCATTCAAGGTTGAAGCTAAGAAAGGTCAATGGCTTCCTGGCTTAGC
CTCTCCTGATTATCTTGATGGCAGTCTCCCAGGAGACAATGGTTTTGATCCATTGGGACTTGCGGAGGACCCAGAGAACTTGAAATGGTTCATCC
AGGCTGAACTGGTGAATGGTCGTTGGGCTATGTTGGGTGTTGCAGGGATGCTGTTGCCTGAAGTTTTCACTAGCATTGGGATACTTAATGTGCCC
AAATGGTACGATGCTGGAAAATCAGAGTACTTTGCATCATCATCCACCCTGTTTGTGATCGAGTTCATCTTGTTCCACTACGTCGAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295431] SGN-U579906 Tomato 200607 Build 2 222 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108156 [Download][View] Facility Assigned ID: TMEDN24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5