EST details — SGN-E294061

Search information 
Request: 294061Match: SGN-E294061
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80836Clone name: cLET-13-I21
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179794 is on microarray TOM1: SGN-S1-1-1.3.1.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179794 [TUS-32-K24] Trace: SGN-T185938 EST: SGN-E372443 Direction: 3' Facility: INRA
Clone: SGN-C179794 [TUS-32-K24] Trace: SGN-T185939 EST: SGN-E372444 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294061Length: 489 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294061 [] (trimmed) CCAATCAAAATATATATATCATATATACTTCTTTGCCTTCCATTAGACATTAGTATAGTACACATGCATAAGATAATGCCACTAGTAGTAAACAA
ACCAAAAGTAAGATAAAATAGAGCTCCCACCTTCTTTGCTTCATTAATACAACCAAATTTAACTCATAAAATCCACCGTATTTCATCAAAATACA
TGTCTTAGAGGACTCGACGATGGGTCCTTACACTCAAGAGAGTGACATCATCGACCACAGGGCCACACAGGGAAACAAAATCATCACTCCTCGTG
TGATAGTAGGTGCTAAGGAACATGATCCTAGTCCGGCTAGCAGTGGCCTTGAAACGGAGGATAGCACGCTTATATCCACCTTTTCCCATAGACTC
ATATGGGACTTTAAGTGTGTCCCTTCCAGCAAAGGCCTCAACAATCATAGAACCTTCACAAGCATTACTTGCATCTCCAACTTTGAAACTAAGTT
GGTACATTTTGCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294061] SGN-U577602 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105904 [Download][View] Facility Assigned ID: TMEBW59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0