Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E293990

Search information 
Request: 293990Match: SGN-E293990
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80987Clone name: cLET-13-P7
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179840 is on microarray TOM1: SGN-S1-1-3.1.1.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179840 [TUS-32-M22] Trace: SGN-T185948 EST: SGN-E372453 Direction: 3' Facility: INRA
Clone: SGN-C179840 [TUS-32-M22] Trace: SGN-T185949 EST: SGN-E372454 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293990Length: 447 bp (912 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293990 [] (trimmed) GTTTCCTGGGCTAAGAAGGAGCTTTCTAAACTCAAACTCCAAAATAAGCCTAAAAGATTGACACTTCCTCAAACTTCCACCAAATGTTTGGCACT
TCCTCTGATTCAGGAAGTGATATTAGATGCAGATCTAAGATGTACCCACTGTCAAAACAGAGTTTCTAGTGTAATTTCAAATATTGAAGATGTGG
AGTCTATCGTGGTGCACGTACTAGAGAAGAAGGTGACTCTTATTCGCAAATCTACAAGTAAATGATGTTGAAAGCAAATTCATTCAAACAAACTA
CTTAGGAACTCAACCATCAATTATGTACAAATGCTTGTGATCATTAACGTGCAGTGTGTGATCTACTTGCTTGATGAAGAATTTCATTTTGTGAG
AAATAAATTGTTGACCTAAACATTGAAGTTCTCATGTAGTAGTAATTATTTCCTTCAACAAAAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293990] SGN-U576120 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105833 [Download][View] Facility Assigned ID: TMEBY88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0080 Quality Trim Threshold: 12.5