Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E293944

Search information 
Request: 293944Match: SGN-E293944
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80966Clone name: cLET-13-O6
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179836 is on microarray TOM1: SGN-S1-1-7.1.1.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179836 [TUS-32-M18] Trace: SGN-T186017 EST: SGN-E372522 Direction: 3' Facility: INRA
Clone: SGN-C179836 [TUS-32-M18] Trace: SGN-T186018 EST: SGN-E372523 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293944Length: 453 bp (795 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293944 [] (trimmed) ACTACAAATTTTCCATAGATTGATTCTCGAGGTCACCTCTTGACAGAGAAAAAAGACCCTCAGGACCCATAGCTAATATTCCGATCAAGGTATGC
TCTTATTTGTCTTTCACAAAAGCGAAACGACAAACCAGGTATGTCATTACAATGATTTAGCCCGTGCACCAAAGGATTGTGGTTACAACCAGCTA
CCAAAAAGAAAAAAAAGGGTCCAGAGAGAGTTTTCTTCTTCAATCAACAGATAAAGTTTTCAACATAATGCCAGAGCCCAATTAGCATTACAGAG
CTGCTACTAATAAACATATGGAGGTACAGGTTCGGAAGCAGAGACTGCTGCAGCATATCAAGACAAGCACTATAATAGGACTACTCGAATTTCTT
TATTAGGGAAAGGTCAGTTAGCATTTTCTCAATTGCTTCCTCGTCAAGTGCACGTCCTCTATTCTTGATGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293944] SGN-U578940 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105787 [Download][View] Facility Assigned ID: TMEBX87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0