Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E293581

Search information 
Request: 293581Match: SGN-E293581
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81322Clone name: cLET-15-L19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182201 is on microarray TOM1: SGN-S1-1-2.4.10.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81322 [cLET-15-L19] Trace: SGN-T106533 EST: SGN-E293582 Direction: 3' Facility: TIGR
Clone: SGN-C182201 [TUS-38-P7] Trace: SGN-T194497 EST: SGN-E393171 Direction: 5' Facility: INRA
Clone: SGN-C182201 [TUS-38-P7] Trace: SGN-T199372 EST: SGN-E398046 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293581Length: 347 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293581 [] (trimmed) GGAAAAGAAATCTTGTTTATTTTATTTTTGGTGAGTTTTTGATTTTCAATTAAGTGAGAAGCAAATGGCCTCAACAACTACCCCTTCACTTTCTC
TCTCTTCTTCATCGACCCTCGTCGACGGCAAGACAACTCGTCAGTCTGCAGCCGTGGCATCGTCGCAATGTGTGACACTACCAACCCTTCCGCCG
CGGCCGGCCGTTCAAAGCCGTGCTGCCAGAACCACTGCTTACTGTAGAAAGATTGCAAGGAATGTGGCCGCAATGGCTACATCAACTGGAGAAGT
TGCCACTGCAGATGCCACAGCTGAAACGGCAACCACTGAGCTACCATCAGAGCTTGTCCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293581] SGN-U581101 Tomato 200607 Build 2 61 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106532 [Download][View] Facility Assigned ID: TMECG70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0192 Quality Trim Threshold: 14.5