EST details — SGN-E293193

Search information 
Request: 293193Match: SGN-E293193
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80530Clone name: cLET-12-I23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184701 is on microarray TOM1: SGN-S1-1-6.4.14.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184701 [TUS-45-H11] Trace: SGN-T198697 EST: SGN-E397371 Direction: 3' Facility: INRA
Clone: SGN-C184701 [TUS-45-H11] Trace: SGN-T200044 EST: SGN-E398718 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293193Length: 486 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293193 [] (trimmed) TTACTTCAAATTCATTTCTCCTTTCAACTACACCTCATCCAAGATTATCATTCAAAAATCCAAGATTCATTGTTTCTGCTAAAAAATCTGGACAA
AATCAAGAAACTACAACCAATTCTGGCAACCCCTTCAACTTTGATTTCGGTAAGTTACCTGATGTGACGTCTTTGATACCTGCTAGCACGAACAC
ATCTTCTGGATTGTCTTTTGGAAGGCAAAGGGCAAAGGATCCTGGAACGGTGTTTGTTGCTGGTGCAACTGGGCAAGCTGGTATCCGCATTGCAC
AGTTGCTGTTGCGTGAAGGTTATAGTGTCAGAGCTGGAGTTTCTGACCTTGGTGCTGCACAAGAGCTAGCTCGTCTAGCCGTTAGCTACAAGGTA
ATCTCTAACGATGAGTCAAAACGTCTGAATGCAGTTGCATCATCATTTCAAGATGCAGAATCGATTGCAAAGGCAATCGGAAATGCTAACAAAGT
TGTGGTTACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293193] SGN-U571962 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105656 [Download][View] Facility Assigned ID: TMEBS60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5