Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E293059

Search information 
Request: 293059Match: SGN-E293059
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80376Clone name: cLET-12-A24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182113 is on microarray TOM1: SGN-S1-1-2.4.10.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182113 [TUS-38-L15] Trace: SGN-T194480 EST: SGN-E393154 Direction: 5' Facility: INRA
Clone: SGN-C182113 [TUS-38-L15] Trace: SGN-T194723 EST: SGN-E393397 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293059Length: 305 bp (933 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293059 [] (trimmed) TTCAATGCTCTTGCCATTAGGAGGTTGAAGGAGATTCAGTGCTATAGAGGAGTAAGGCACATCCAAGGATTGCCTTGCAGAGGACAACGAACAAA
GAACAATTGCCGTACTTTGAAGGGCAAGAAAGTAGCAATTGCAGGGAAGAAGAAGGCACCTCGTTAAATCAAGATCGATTTTTCATTTCTTTTGG
TAACTAACTTGTAAAAGTTACACTCTATATTCCTATGGCAAACTGTGCATTTGTTTGTTATAAACAGTTTTTTCCATTGAAATCATTTTTCTACA
TTTCAAGATAAGAGCTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293059] SGN-U566487 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105522 [Download][View] Facility Assigned ID: TMEBT12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0013 Quality Trim Threshold: 12.5