Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E292996

Search information 
Request: 292996Match: SGN-E292996
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80386Clone name: cLET-12-B17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C183242 is on microarray TOM1: SGN-S1-1-1.3.3.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183242 [TUS-41-K16] Trace: SGN-T196514 EST: SGN-E395188 Direction: 5' Facility: INRA
Clone: SGN-C183242 [TUS-41-K16] Trace: SGN-T199479 EST: SGN-E398153 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292996Length: 481 bp (910 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292996 [] (trimmed) CCGCACTGCCAATGGACGAGAAGCGTGCCACTGCATTCGGTCTCATGAAGATTGATGAAGAAGGACGCATTATTGAATTTGCAGAGAAACCGCAA
GGAGAGCAATTGCAAGCAATGAAAGTGGATACTACCATTTTAGGTCTTGATGACAAGAGAGCTAAAGAAATGCCTTTTATCGCCAGTATGGGTAT
ATATGTCATTAGCAAAGACGTGATGTTAAACCTACTTCGTGACAAGTTTCCTGGGGCCAATGATTTTGGTAGTGAAGTTATTCCTGGTGCAACTT
CATTTGGGATGAGAGTGCGAGCTTATTTATATGATGGGTACTGGGAAGATATTGGTACCATTGAAGCTTTCTACAATGCCAATTTGGGCATTACA
AAAAAGCCGGTGCCAGATTTTAGCTTTTACGACCGATCAGCCCCAATCTACACCCAACCTCGATATTTGCCACCTTCAAAAATGCTTGATGCCGA
TGTCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292996] SGN-U577904 Tomato 200607 Build 2 86 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105459 [Download][View] Facility Assigned ID: TMEBU09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0178 Quality Trim Threshold: 14.5