EST details — SGN-E292943

Search information 
Request: 292943Match: SGN-E292943
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80266Clone name: cLET-11-L22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179705 is on microarray TOM1: SGN-S1-1-2.4.1.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179705 [TUS-32-H7] Trace: SGN-T186062 EST: SGN-E372909 Direction: 3' Facility: INRA
Clone: SGN-C179705 [TUS-32-H7] Trace: SGN-T186063 EST: SGN-E372910 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292943Length: 477 bp (945 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292943 [] (trimmed) CCTTGGTGCTGTTAGGACTTGTCAAAAAGAAGGAAGGTGTCCACTTATCGGTTCAATCCATTTTCTCAGCTCTCCATTCCCATCTACTCTAAAAT
CGTTAAAGTATAAAAATAACACAAGGATGCAAGCAGTGGAAGAAGAATATGAGTTGAAGCAAATGAAAGATATGGCTGCGGCTAAGAAGAGATGG
GATGCTCTGATCAGGGATGGGACAGTTAAGGTTCTTACTCCAAGGGAAGCTGGTTATGCAATTCAACTCTCAAACAAAATGCTGCTTGATGTTCG
TCCCTCTATGGAGCGAAAGAAGGCATGGGTAAAAGGCTCCACCTGGATTCCAATTTTTGATGTTGATGCTAGTTTAGAACTTCGTACTCTTTCCT
TGAAAGCAACAAACTTTTTGATGGGAGGTTGGTGGAGTGGTGTCCCTGCTCTTTCTTACAACAAAGAATTCTTATCAAATGTTGAGGAGAAATTT
GC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292943] SGN-U572438 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105406 [Download][View] Facility Assigned ID: TMEBR71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5