EST details — SGN-E292786

Search information 
Request: 292786Match: SGN-E292786
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80033Clone name: cLET-11-A9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184952 is on microarray TOM1: SGN-S1-1-3.2.12.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184952 [TUS-46-B22] Trace: SGN-T191991 EST: SGN-E390665 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292786Length: 366 bp (882 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E292786 [] (trimmed) GTCGCAGAGCAGTCAACCTAAGGGATCTTCCAACTCACTTGCTGATAAATTCGATTCAAACTTATATTTGGGCAATTCTAAGAATTCAGCTAGTG
GAGTAGGTTCTATGCCTACAGAGACAAAAGGCTCACAAGGGACAGCTGATCAGGAAAGAAAGAATTCTACTAAGGACAGCTCAGCATCAGCCAAA
GTTAGTGATGGGGCTAGCAGTATTGCAAAAACAAGTGGAAGTGCCAAAATTAGTGATCGAGCAGATTTTCTTGAGAGTGGTAAGAGCAGCATCTG
TAGGGGGAGCACAGGAACTGACGTAAGTGAGGAGAGTACTTCTAGCAGCTTGAGCAGCAGCGTTAACAAACCCCACAAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292786] SGN-U567366 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105249 [Download][View] Facility Assigned ID: TMEBO05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0123 Quality Trim Threshold: 14.5