Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E292760

Search information 
Request: 292760Match: SGN-E292760
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80129Clone name: cLET-11-F18
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179649 is on microarray TOM1: SGN-S1-1-2.1.1.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179649 [TUS-32-E23] Trace: SGN-T185736 EST: SGN-E373073 Direction: 3' Facility: INRA
Clone: SGN-C179649 [TUS-32-E23] Trace: SGN-T185737 EST: SGN-E373074 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292760Length: 436 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292760 [] (trimmed) GAAAATGGCGGCTTCTCCTCTTCTTCTACACTCCACGGCCTCCTCTTTCTACAATGCTGAGTTTCCGGCGTACTCCGTTCGATTGCCGGTCGGAA
ATACCAAGGTCCGGTCGTCCAATAAATTGACGGTGAAAGCTTCAGCAACAGTACTAGTGGATAAAAGTGAAGCTGAAAAAGTTAATCGTCTGAAA
ACAAATTACCTCGAAAAGATTGTGCCGTTGTTGAAGGAAGAATTCAGTTACACCAATATTCTTCAGGTTCCGAAGGTCGAAAAGATTGTGGTAAA
TTGTGGTATAGGAGATGCTGCACAAAATTCCAAGGGTTTGGATGCAGCAATGAATGATTTGGCCTTAATTACAGGGCAAAGGCCTGTGAAGACTA
GGGCTAAGAATGCTATTGCTACTTTCAAAATTAGAGAAGGTCAACCGCTTGGAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292760] SGN-U580731 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105223 [Download][View] Facility Assigned ID: TMEBR33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5