EST details — SGN-E292697

Search information 
Request: 292697Match: SGN-E292697
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80034Clone name: cLET-11-B1
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179607 is on microarray TOM1: SGN-S1-1-4.4.1.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179607 [TUS-32-D5] Trace: SGN-T186126 EST: SGN-E372973 Direction: 3' Facility: INRA
Clone: SGN-C179607 [TUS-32-D5] Trace: SGN-T186127 EST: SGN-E372974 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292697Length: 441 bp (808 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292697 [] (trimmed) GGATTTATAGCCCGAGACATAACATTTGAGAACACATCAGGACCCGAAAAGCACCAAGCAGTAGCATTTCGTTCCGACTCAGATTTATCGGTCTT
GTTCCGATGCGCGGTGAGGGGTTACCAAGACACTCTCTACGCCCACTCAATGCGTCAATTCTACAGAGACTGTACAATTACTGGCACAGTCGATT
TCATTTTTGGAGACGGTACAGCTATTTTTCAAAACTGTCAAATATTAGCACGAAAAGGATTGTCACAACAGAAAAACACAATCACAGCACAAGGT
CGAAAAGAAATTGCTGAAACAACAGGTTTCACGATTCAATTTTGTAACATATCTGGTGAACCGGATCTATTAACTTCACTCAATTCTACGTATAC
GTATCTTGGAAGACCATGGAAGACGTATTCGCGAACAGTGATCATGCAATCGTACATGAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292697] SGN-U564773 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105160 [Download][View] Facility Assigned ID: TMEBQ01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5