EST details — SGN-E292319

Search information 
Request: 292319Match: SGN-E292319
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82426Clone name: cLET-1-O11
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179575 is on microarray TOM1: SGN-S1-1-4.2.1.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82426 [cLET-1-O11] Trace: SGN-T102594 EST: SGN-E292320 Direction: 3' Facility: TIGR
Clone: SGN-C179575 [TUS-32-B21] Trace: SGN-T186122 EST: SGN-E372969 Direction: 3' Facility: INRA
Clone: SGN-C179575 [TUS-32-B21] Trace: SGN-T186123 EST: SGN-E372970 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292319Length: 471 bp (547 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292319 [] (trimmed) CTTGGATCCATACCTTTCCACCTGTCCACCATTTTGCTTCCTCTCAAAAACCATCAATTCTAACCTCTGATCCAAATACAAAGCATAAGTCCTTA
CAAAAGCAGAATGATCCCATGAACTGGCGTGAGCTTCATCTCTGAAATCTGATAAATTTAGCAGCCTTGTTCCCCTCCTGGTAGCATACATAATT
TCTTGCTGAAATACAGCATCTCCATCATTGAGAAGTCGGTGAATTAGCATCAAACACTTGAGGGCAACAATCCAATCTCGGGTTTTGCCCAACCT
TTTGGAAATTGCAGACATGCAGGCAGTGACATAACCCCGTGAAGATGAAGTCAATTGGAGAATCTCCCTTATGTACTTCTCTCCAGCTGGTTCAT
CATCGTGGCTAGTAGCCTTAACAATAGCAACTTCCAGCTCTGGTGCCATGTTGCTTGCCACTTTGGCAATCCCTATGCTGGTCTGGTCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292319] SGN-U586145 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102593 [Download][View] Facility Assigned ID: TMEAA90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5